• This is a political forum that is non-biased/non-partisan and treats every person's position on topics equally. This debate forum is not aligned to any political party. In today's politics, many ideas are split between and even within all the political parties. Often we find ourselves agreeing on one platform but some topics break our mold. We are here to discuss them in a civil political debate. If this is your first visit to our political forums, be sure to check out the RULES. Registering for debate politics is necessary before posting. Register today to participate - it's free!
  • Welcome to our archives. No new posts are allowed here.

What Does It Mean To Be Human?

Mr. Invisible

A Man Without A Country
Supporting Member
DP Veteran
Monthly Donator
Joined
Feb 20, 2010
Messages
5,569
Reaction score
4,039
Location
United States
Gender
Male
Political Leaning
Other
People would like to say that being human means having a soul, being more intelligent than animals, or just have opposable thumbs tongue4, but when one puts that aside, we really have no idea what it means to be a human. I do not have an answer to this myself, thus I was wondering what people here at DP thought.
 
Its just the particular species of animal we are.The universe existed long before use and will continue long after we are gone.
 
Being Human is being part of our species, which is defined as a group of living beings who can breed with each other to produce another reproductive being.
 

I think the main thing that separates man from animal, speaking ideologically, is a set of morals. It is the basis of what help humans progress and live together in relative peace.
 
WeAreReborn said:
I think the main thing that separates man from animal, speaking ideologically, is a set of morals. It is the basis of what help humans progress and live together in relative peace.
Click to expand...

I don't know. I would say that if we're talking about the separation between man and animal, ours is due to our intelligence and extelligence.
 

There are many things that separate humans from animals, not the least of which is that we recognize our own mortality. Other than animal instinct, we have no reason to believe that any other species on planet earth realizes they will die some day. That's huge.
 
Being human is an objective measure of one's belonging to the species homo sapiens. Being a person is a measure of belonging to a given civilization.
 

Elephants appear to do some sort of ceremony when one of them dies.
 
Humans are just smart enough to precipitate mass death, but still dumb enough to actually wish for it.
 

Aren't those three things sufficient to be human? :shrug:
 

It means you will never have knowledge that excludes the universal laws of nature!
 
WeAreReborn said:
I think the main thing that separates man from animal, speaking ideologically, is a set of morals. It is the basis of what help humans progress and live together in relative peace.
Click to expand...

You could bring up the argument that those morals might not help us ‘progress’ and ‘live togher in relative peace’ any better than animals without moral judgement. The animal kingdom may be a more violent, survival mode kind of place, but far fewer ‘pointless’ murders, genocides, etc based on moral judgement, take place.

If we don’t kill them off with us, animals would likely outlive us in relative harmony with their ecosystem until the sun implodes…


I think being human is understanding how small and pointless we are in the ‘cosmic’ scheme, while accepting responsibility as the caretakers of the planet in our pursuit of knowledge and truth for the betterment of animal-kind, not a bottom-line, defining success as the ever-existing journey toward balance of all things.

Peace
 

Humans are the only species with consciousness.
 
reefedjib said:
Humans are the only species with consciousness.
Click to expand...

What do you mean by consciousness and how do you know humans are the only species with it?
 
spud_meister said:
Something along the lines of: GTACTCAGTACGATGACGATGACGTGCACAGTGATGACGACAGATAGACAGATAGACCAGATGAGCAGATGACAGATGACACCAGATGACAGATGATTGATGAGAGGCAGATCAGATC
Click to expand...

I've heard an internet rumor that the gene sequence of Ausies is reversed, though. It's like the way you can't get your water to spiral with the right rotation.

Any truth to that one?
 
alexa said:
What do you mean by consciousness and how do you know humans are the only species with it?
Click to expand...

Consciousness is variously defined as subjective experience, awareness, the ability to experience "feeling", wakefulness, the understanding of the concept "self", or the executive control system of the mind.
Click to expand...

Furthermore it produces a "Theory of the mind" allowing self-reflection on your own thoughts.

The most cognitive animals, Chimpanzees, cannot understand the concept of self, nor create a theory of the Mind.
 
reefedjib said:
.

The most cognitive animals, Chimpanzees, cannot understand the concept of self, nor create a theory of the Mind.
Click to expand...

That is debatable. Chimpanzees recognize themselves in a mirror, for instance, as do some cetaceans as well as birds like crows and magpies.
 
Gardener said:
That is debatable. Chimpanzees recognize themselves in a mirror, for instance, as do some cetaceans as well as birds like crows and magpies.
Click to expand...

That does not imply consciousness.
 
reefedjib said:
Furthermore it produces a "Theory of the mind" allowing self-reflection on your own thoughts.

The most cognitive animals, Chimpanzees, cannot understand the concept of self, nor create a theory of the Mind.
Click to expand...


The Goshin Hypothesis of sentience:


Insect: 0
Lizard: 1
Squirrel: 2
Horse: 5
Dog: 6
Chimpanzees and Cetaceans: 8-15, depending on this and that.

Humans: 100

Chimps and dolphins are vastly closer to sentience than squirrels.... but the gulf between them and humans is huge.
 
reefedjib said:
Furthermore it produces a "Theory of the mind" allowing self-reflection on your own thoughts.

The most cognitive animals, Chimpanzees, cannot understand the concept of self, nor create a theory of the Mind.
Click to expand...

yes it is a difficult one, going on from your quote

In this respect I watched a program on dolphins where they were training them and then the dolphins took over and started creating their own games. They were questioning whether this might mean they had a similar consciousness to us. Some elephant also show characteristics which seem to indicate something more.

What we do know is that we managed to get sufficient food to provide sufficient nutrition and growth of our brain and also that we seem to be unique in the capabilities of our voice box. I know animals can make noises but what we can do with our voices is amazing. In this way we can communicate and language is very important. Perhaps it is a chicken and egg situation but languages which do not possess certain words also do not possess the corresponding action or feeling, though I guess all that will change with globalisation. Animals however can exchange very little in the way of ideas.

I suspect that at least some animals, dolphins for example are capable of consciousness, probably many more and what makes the difference is our language, our ability to make tools and provide needed food.

Of course what we do with our consciousness and how we experience it will be an individual thing.
 
Last edited:

I think animals know they will die or have a sense of mortality.. I have watched animal programs and it's been pointed out that many pack animals stop to grieve the death of a pack member. I also know crows specifically mourn other dead crows.

We might not really understand animals because we complicate our own existence more than theirs, but are more like them than we realize :shrug:

 
Gardener said:
That is debatable. Chimpanzees recognize themselves in a mirror, for instance, as do some cetaceans as well as birds like crows and magpies.
Click to expand...

My dog recognizes herself in the mirror.. She barks at herself and poses.. wtf :lamo
 

Yes animals certainly seem to have become a lot cleverer in my lifetime or as we have started to study them more. Baby elephants who have watched their mums being murdered by poachers have to go through psychological therapy and orang-utans who were orphaned because of the cull of their parents turned into aggressive gang members but when reintroduced to ordinary orang-utan life readjusted. I am sure we have a lot more to learn.
 
You must log in or register to reply here.
Menu
Log in
Register
Cookies are required to use this site. You must accept them to continue using the site. Learn more…