• This is a political forum that is non-biased/non-partisan and treats every person's position on topics equally. This debate forum is not aligned to any political party. In today's politics, many ideas are split between and even within all the political parties. Often we find ourselves agreeing on one platform but some topics break our mold. We are here to discuss them in a civil political debate. If this is your first visit to our political forums, be sure to check out the RULES. Registering for debate politics is necessary before posting. Register today to participate - it's free!
  • Welcome to our archives. No new posts are allowed here.

Why creationism is a total farse

Not only that, but religion is not required to produce a viable commercial application.
Science is a means by which we discover the rules and laws of the natural world. It just happens that knowledge of reality is extremely useful when developing tools.

Religion is a set of values by which you live.
Many people live complete and happy lives without submitting to the dogma and doctrine of a particular religion or holy-book.
 
??? Perhaps I'm just not making the connection...how does the existence of gasoline make you reject creationism?

Easy. Evolution and YEC are two views upon how life can to be how it is. Evolution provides tangible products. Creationism provides nothing but propaganda. Disgbe ran away from my request for him to provide a single non-propaganda piece of commercialized creationism. Writing books about why evolution is wrong is hardly the same as utilizing evolution to find specific genes from related organisms to provide genetically applicable immunity to pests to boost crop yields. A theory that describes and predicts how life came to be would reflect natural properties of the world. A theory that doesn't describe or predict how life came to be would not reflect the natural properties of the world. Creationism has done nothing to provide tangible commercial products. Therefore I accept the theory that actually does reflect the natural world.

As for gasoline, it's not the existence. It's how we find it. Evolution makes predictions based on the geological and biological history of the planet as to where large amounts of hydrocarbons should exist. Under Creationism, oil and gas should be found only in the low points on the planet based on the receding waters of the flood. There actually shouldn't be any large deposits of gas on land as the waters and all of the organic material would have been swept out to sea. Basically Creationism is arguing that the massive deposits in Saudi Arabia, Alaska, Russia and Iraq should not exist.. When you have a belief that contradicts what we see with our own eyes, there's a big problem there.

And as for the creationist boy... Just because he was uneducated in debate and defending his opinions does not make his opinions wrong.

Being uneducated is irrelevant as to why your opinions may be wrong. An opinion based on a belief contrary to testable facts, facts you can test in your own sink make your opinion wrong. Or God's a liar. I'm not comfortable with that one, therefore I go with wrong opinions.

[quote[Everyone gets upset when someone questions their fundamental beliefs, especially when we have not thought through how to defend them. He was just a boy.[/quote]

Then it is his job to review his beliefs. If he cannot defend them then perhaps they are not worth having?

A boy believing any religion, be it Christianity or Buddhism or atheism or Muslim etc. would have trouble defending his own beliefs.

But not all Christians, Buddhists or Muslims belief in something that contradicts the actions occurring in their own sink. I have no respect for YECs because their belief says to me as I drop a dutch oven and plastic flat plate into my sink filled with water that they should sink at the same rate or by which item is more complex.

Not only that, but religion is not required to produce a viable commercial application. Religion is a set of values by which you live.

True. It's when you say that your religious belief (one not shared by everyone in your belief) is scientific fact then we have issues. But you bring up a good point. Religion is a set of values which you live by. If one of your religious belief mandates that you reject products from a theory you think is false, how can you live by those values if you use those products?
 
take a long objective look at our chaotic and random universe. the idea that life and existence is based on a omnipotent ruler and a set of guiding principles and commandments is totally ridiculous.
 
take a long objective look at our chaotic and random universe. the idea that life and existence is based on a omnipotent ruler and a set of guiding principles and commandments is totally ridiculous.

Chaotic and random?

We can predict with precision just where any given celestial body will be in a given amount of time. We can count on the planets to continue to orbit around the sun in predictable ways. We live on a planet that is just the right temperature, has exactly the right compounds and elements to sustain life. If there is something that appears chaotic and random, it is because of our own incomplete understanding.
 
Science is a means by which we discover the rules and laws of the natural world. It just happens that knowledge of reality is extremely useful when developing tools.


Many people live complete and happy lives without submitting to the dogma and doctrine of a particular religion or holy-book.

But unless their lives are completely random and sporadic, then they live by a set of values. Religion is not necessarily based upon a holy book, and to assume so is to misunderstand the definition of religion.
 
Then it is his job to review his beliefs. If he cannot defend them then perhaps they are not worth having?



But not all Christians, Buddhists or Muslims belief in something that contradicts the actions occurring in their own sink. I have no respect for YECs because their belief says to me as I drop a dutch oven and plastic flat plate into my sink filled with water that they should sink at the same rate or by which item is more complex.



True. It's when you say that your religious belief (one not shared by everyone in your belief) is scientific fact then we have issues. But you bring up a good point. Religion is a set of values which you live by. If one of your religious belief mandates that you reject products from a theory you think is false, how can you live by those values if you use those products?

Am I to understand that when you were young you were able to, with thought-out arguments and brilliant apologetics, defend your beliefs down to the last detail? Children do not understand anything they believe, or why they believe it. They are merely parroting someone else.

Not only that, but I find the reference to oil to be moot, considering the fact that oil takes millions of years to form and the Flood occured a few thousand years ago, give or take. The Flood would not have affected oil.

Also, you are assuming that Christianity states that oil is -- false, was it? -- when it does not. While there are some radicals out there, I fail to see where in the Bible it says that oil is false. Not only that, but I also fail to see where 1) Christianity claims to be fact and 2) Christianity opposes fact. Please give me some examples so that I may refute your claim.
 
take a long objective look at our chaotic and random universe. the idea that life and existence is based on a omnipotent ruler and a set of guiding principles and commandments is totally ridiculous.

So DNA, the fact that stars exist, and the fact that basically every natural phenomenon can be explained by a mathematical equation goes to show that the universe is random? If the universe was random, some laws of physics would apply some of the time, and some would never apply except when, of course, they did apply. Also, how is it you exist? If the universe is chaotic, then how could you, a complex, willful, intelligent (I'm assuming) being have come to be? How did life come from nothing if the universe is chaotic? If all existence tends to decay, how did something like you come to be?

Not only that, but guiding principles and commandments? Well, there are the laws of physics, and then that whole conscience thing...

Take a long objective look at our universe and if you do not see that there is some form of intelligent being that runs things, then you must apply all the implications of that worldview to yourself: you are an uncaused, useless, mistake of nature that has no meaning, no purpose, and no use on this planet.
 
But unless their lives are completely random and sporadic, then they live by a set of values.
Yes, and?

Religion is not necessarily based upon a holy book
I agree. Not all are. But Christianity is a book based religion. It is heavily reliant on the belief that the stories within the Bible are factual history. It is heavily reliant on the belief that the laws and commandments within it are god breathed.
 
Yes, and?QUOTE]

I was responding to your claim that people live happy lives without following some particular religious dogma by saying that a set of values does not necessarily mean "a set of values that is widely accepted and acknowledged by large amounts of people."
 
Yes, and?


I agree. Not all are. But Christianity is a book based religion. It is heavily reliant on the belief that the stories within the Bible are factual history. It is heavily reliant on the belief that the laws and commandments within it are god breathed.

Well, up to a point. Christians believe that Christ lived, that he died for the sins of mankind. Only the "fundamentalists" insist on believing that the Old Testament stories of the creation myth and the universal flood are historical accounts. Most of the mainstream believe that the flood was an allegory, and that evolution is a solid theory.
 
Well, up to a point. Christians believe that Christ lived, that he died for the sins of mankind. Only the "fundamentalists" insist on believing that the Old Testament stories of the creation myth and the universal flood are historical accounts. Most of the mainstream believe that the flood was an allegory, and that evolution is a solid theory.

Right.....And I'm sure that is also why 60% of Americans reject evolution, because they believe the Bible contains myths and allegories.:roll:

Liberal Christians are still a minority in America. Fundamentalism/Biblicists/Literalism reigns.

On Darwin
American Beliefs: Evolution vs. Bible's Explanation of Human Origins
 
Right.....And I'm sure that is also why 60% of Americans reject evolution, because they believe the Bible contains myths and allegories.:roll:

Liberal Christians are still a minority in America. Fundamentalism/Biblicists/Literalism reigns.

On Darwin
American Beliefs: Evolution vs. Bible's Explanation of Human Origins

60%? No (bleep)? 60% of Americans reject science in favor of fairy tales? That's amazing.
Anyway, Catholics and Episcopalians have no problem with evolution. Maybe it's just the individuals who slept through biology class who are among that 60%.
 
Oh my...

First problem here is that people are trying to define terms in ways that either do not fit the scientific understanding of what those terms mean, or terms that science either does not have a readily available definition for, or that science is regularly amending its understanding of.

Matter has been defined in many ways through history. A basic definition is that matter is anything that has mass and occupies a volume. Another is that matter is anything that is composed of quarks and leptons. There are many kinds of particles that are not considered matter, such as photons and force carrying particles. Energy is defined as the ability to do work, with "work" being defined as the ability to exert a push or pull on the forces of nature.

Matter CAN be created and/or destroyed. But energy and mass cannot. Matter contains energy, and the mass of an object has equivalency with the energy of the object in such a way that can be mathematically expressed as E=mc^2.

Too-Shay Gekaap...and I'd like to add to your post, if you don't mind.

1. Everything in the Universe is made up of matter and energy.

2. Matter is anything that has mass and occupies space. Properties of Matter Include:
Color, shape, size, hardness, texture, malleability, porosity, conductivity, odor, and mass (by the way, "Mass" is a numerical measure and "Weight" is of an object is defined as the force of gravity on the object).

3. Matter describes the physical things around us: the earth, the air you breathe, your pencil. Matter is made up of particles called atoms and molecules. Atoms are particles of elements - substances that cannot be broken down further.

4. There are currently 109 known elements, but obviously there are more than 109 different
substances in the universe. This is because atoms of elements can combine with one another
to form compounds.

5. There are 4 fundamental states of matter: solid, liquid, gas and plasma.

6. Energy is the ability to cause change or do work.

7. Some forms of energy include light, heat, chemical, nuclear, electrical energy and
mechanical energy.

8. There are two main types of energy: potential and kinetic. Potential energy is energy
that is stored, while kinetic energy is energy in use.

9. In order for electrical energy to flow, it must follow a complete path through a circuit.

10. Dark matter refers to material that can't be detected by their emitted radiation but
whose presence can be inferred from gravitational effects on visible matter, like stars
and galaxies. Dark energy, or negative energy, is the energy found in space.

How Science Works:

Science consists of posting testable, falsifiable hypotheses; making predictions about what is not yet known; performing critical experiments or observations that can disprove certain alternative hypotheses and lend credence to others; seeking explanations in natural rather than supernatural causes; trying to falsify hypotheses rather than to prove them; remaining skeptical until independent investigators are able to corroborate new claims; and subjecting one's ideas and data to the merciless criticism of other scientists.

A question I have: Has any scientist who believes creationism or some so-called scientific religious group ever verifiablely proved any major scientific discoveries like E=MC2 wrong? If so, I hope someone posts such findings.
 
60%? No (bleep)? 60% of Americans reject science in favor of fairy tales? That's amazing.
Actually if you look at the poll is 25% who reject it and 35% who don't have an opinion.

If you ask about human evolution then it become 60% reject and 40% accept.

Americans are the laughing stock of the modern world thanks to fundamentalist Christians and the Far Right who constantly seek to undermine and retard our children's education system.

Anyway, Catholics and Episcopalians have no problem with evolution. Maybe it's just the individuals who slept through biology class who are among that 60%.
The numbers are gradually getting better but its difficult to educate people on the facts when many pastors/preachers/priests are constantly working against it. When those people are proclaiming that their religious beliefs are irreconcilable with scientific discovery therefore science (and not one's religion or interpretation of a particular holy book) is wrong.
 
So DNA, the fact that stars exist, and the fact that basically every natural phenomenon can be explained by a mathematical equation goes to show that the universe is random? If the universe was random, some laws of physics would apply some of the time, and some would never apply except when, of course, they did apply. Also, how is it you exist? If the universe is chaotic, then how could you, a complex, willful, intelligent (I'm assuming) being have come to be? How did life come from nothing if the universe is chaotic? If all existence tends to decay, how did something like you come to be?

Not only that, but guiding principles and commandments? Well, there are the laws of physics, and then that whole conscience thing...

Take a long objective look at our universe and if you do not see that there is some form of intelligent being that runs things, then you must apply all the implications of that worldview to yourself: you are an uncaused, useless, mistake of nature that has no meaning, no purpose, and no use on this planet.

yeah thats exactly the thing. the universe doesn make a whole lot of sense, sure scientists find out this and that about stuff, and can tell you whats going to happen and when but not why or how. take an atom for example. we kno that matter can be broken down to atoms, but also further, and starts to go into stuff that scientists cant understand. electrons move completely at random swerving paths around the nucleas and for some reason dont brake off but we dont know why. and anotehr thing, **** you how do u tell me i have no use on this planet u prick what the **** have you done with your life how come your debateing this **** with me and not teaching me what to believe i thought u had all the answers??
 
yeah thats exactly the thing. the universe doesn make a whole lot of sense, sure scientists find out this and that about stuff, and can tell you whats going to happen and when but not why or how. take an atom for example. we kno that matter can be broken down to atoms, but also further, and starts to go into stuff that scientists cant understand. electrons move completely at random swerving paths around the nucleas and for some reason dont brake off but we dont know why. and anotehr thing, **** you how do u tell me i have no use on this planet u prick what the **** have you done with your life how come your debateing this **** with me and not teaching me what to believe i thought u had all the answers??

Would you please calm down? I was applying the implications of that specific worldview to the definition of humanity. I personally do not agree with that picture of humanity, I was merely giving an illustration.
 
No no no it does say that everything was created in six days according to the bible the earth is only 6000 years old I just read Genesis 1 and it says that in six days all of gods creations were
"God made the wild animals according to their kinds, the livestock according to their kinds, and all the creatures that move along the ground according to their kinds. And God saw that it was good."
The day after that he made man
Well do you realize that dinosaurs would eat humans? I have no way of proving this but there have been several mass extinctions here on earth and if everything was created at once then humans would have been extinct right along with the dinosaurs

The bible is a very rich book; a part of that richness is the necessity to use it to translate itself so to speak.

For example: "With the Lord a day is like a thousand years, and a thousand years are like a day." 2 Peter 3:8

Looking back at Genesis the Hebrew word there didn't indicate a 24 hour period, rather an indeterminate period of time much like the use of "day" in 2 Peter (in Greek, same concept).

Ergo, 6000 year earth literalists don't know their bible very well, and if you are honestly interested in reading it keep that concept at the forefront.
 
==================
Category ( A ) = the result of: ( totally ) un-unconscious un-guided chaotic-randomized /
space and earth driven / natural forces and processes . . . no intelligence
==================
Category ( B ) = the result of: ( self-aware ) contemplating-calculating /
purpose-guided / agenda-driven expression/s of a designer-mind . . . intelligence
==================
1.) A or B ? . . . the Rocky Mountains
2.) A or B ? . . . the faces carved into Mount Rushmore
3.) A or B ? . . . tornadoes / hurricanes and snowflakes
4.) A or B ? . . . Morse code
5.) A or B ? . . . DNA code
==================
 
My purpose with this thread is to explore any "merit/s" of atheism ..
In order for atheism to pose any real Rationale ..
atheists must convince me that DNA is the product of ( according to the latest science )
Category A ( no designer / mind ) not B ( calculating / intelligence )
So far I'm not convinced .. the evidence I see in DNA .. points to a UNIVERSAL SUPER INTELLIGENCE
( apply it to whoever you wish )


category A or B . . . all my things science and ID . . . Lee Strobal . . . questions for atheists . . . DNA defined
computer code - language . . . all those ones and zeros . . . encoder and a decoder . . . pebbles below a rapids
patterns vs codes . . . walking along the beach . . . expelled



 
"A big, fundamental question, like belief in God (or disbelief),
is not settled by a single argument,"

said physicist-turned-theologian John Polkinghorne. "It's too complicated for that.
What one has to do is to consider lots of different issues and see whether or not the answers
one gets add up to a total picture that makes sense." ..

That's the approach I ( Lee ) took in my investigation.
I probed six different scientific disciplines to see whether they point toward or away
from the existence of an intelligent designer.



please visit: Evidence of God from DNA by Lee Strobel . . . link
 
atheists need to explain how cells and DNA code ( a digital language-communication system / structure )
develope from ( totally ) un-unconscious chaotic-randomized / space and earth driven /
natural forces and processes .. ie: (category ( A ) no intelligence) . . . ?
 
DNA: is a nucleic acid that contains the genetic instructions
used in the development and functioning of all known living organisms and some viruses.
The main role of DNA molecules is the long-term STORAGE OF INFORMATION.
DNA is often compared to a set of blueprints, like a recipe or a code,
since it contains the instructions needed to construct other components of cells,
such as proteins and RNA molecules.
The DNA segments that carry this genetic information are called genes,
but other DNA sequences have structural purposes,
or are involved in REGULATING the use of this genetic information . . . . wikipedia
===============
DNA: arranged in approximately 3 billion PRECISE sequences ..
enough information to fill an entire set of Encyclopedia Britannica ..
Please visit: .. Cell's Design Podcast



 
To put it into layman’s terms “the amount of information in human DNA is roughly equivalent to
12 sets of The Encyclopaedia Britannica .. an incredible 384 volumes" worth of detailed information that would fill 48 feet of library shelves!” . . . At the same time this immense amount of information is contained in a space that is only 2 millionth of a millimeter thick . . . Quoting molecular biologist Michael Denton, Sieglie explains that a teaspoon of DNA, “could contain all the information needed to build the proteins for all the species of organisms that have ever lived on the earth, and "there would still be enough room left for all the information in every book ever written."
===============
Let's first consider some of the characteristics of this genetic 'language.'
For it to be rightly called a language, it must contain the following elements:

__ an alphabet or coding system,
__ correct spelling,
__ grammar (a proper arrangement of the words),
__ meaning (semantics) and an intended purpose.

Scientists have found the genetic code has all of these key elements.
"The coding regions of DNA," explains Dr. Stephen Meyer ..
"have exactly the same relevant properties as a computer code or language."
 


DNA in our cells is very similar to an intricate computer program .. The sequencing and ordering of these ones and zeros is what makes the computer program work properly .. IN THE SAME WAY .. DNA is made up of four chemicals, abbreviated as letters A, T, G, and C . . . Much like the ones and zeros, these letters are arranged in the human cell like this: CGTGTGACTCGCTCCTGAT and so on . . . The order in which they are arranged INSTRUCTS the cell's actions .. What is amazing is that within the tiny space in every cell in your body, this code is three billion letters long

COMPUTER DIGITAL BINARY CODE = 001001011010110100100101001010010010110100101101001010010100
100101001001010010010110101101001001011010010110100101001010
010010110101101001001010010100100101101001011010010100101001
001010010010100100101101011010010010110100101101001010010
= the language of internet
===============
GENOME = EACH CELL IN YOUR BODY = CGTGTGACTCGCTCCTGATCGTGTGACTCGCTCCTGATCGTGTGACTCGCTCCT
GATCGTGTGACTCGCTCCTGATCGTGTGACTCGCTCCTGATCGTGTGACTCGCT
CCTGATCGTGTGACTCGCTCCTGATCGTGTGACTCGCTCCTGATCGTGTGACTC
GCTCCTGATCGTGTGACTCGCTCCTGATCGTGTGACTCGCTCCTGATCGTGTGA
CTC-> -> -> -> -> 3 BILLION LETTERS LONG
= the language of life

Please visit: Barry Schuler: Genomics 101




 
Back
Top Bottom